atp5s

Ensembl ID:
ENSDARG00000012072
ZFIN ID:
ZDB-GENE-040426-959
Description:
ATP synthase subunit s, mitochondrial [Source:RefSeq peptide;Acc:NP_956512]
Human Orthologue:
ATP5S
Human Description:
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B) [Source:HGNC Symbol;Ac
Mouse Orthologue:
Atp5s
Mouse Description:
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35557 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006923 Nonsense 28 199 2 5
ENSDART00000136030   None 169 2 5
Genomic Location (Zv9):
Chromosome 13 (position 37082848)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36555150
GRCz11 13 36680982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCCGCTCATAAGCAGCCGTCAGGGGGCAGACGAGAGTTCTGGGGCTG[G/A]CTGAATGCTGTTTTCAACAAGTAAATATGCATATTTTCCAAAACAACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link