zgc:101594

Ensembl ID:
ENSDARG00000012044
ZFIN ID:
ZDB-GENE-040912-67
Description:
hypothetical protein LOC447901 [Source:RefSeq peptide;Acc:NP_001004639]
Human Orthologue:
POLR3GL
Human Description:
polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like [Source:HGNC Symbol;Acc:28466]
Mouse Orthologue:
Polr3gl
Mouse Description:
polymerase (RNA) III (DNA directed) polypeptide G like Gene [Source:MGI Symbol;Acc:MGI:1917120]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18164 Nonsense Available for shipment Available now
sa36840 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013666 Nonsense 88 218 4 8
ENSDART00000132660 Nonsense 91 221 4 8
Genomic Location (Zv9):
Chromosome 19 (position 25039079)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24969191
GRCz11 19 24553414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTTTNCTTTCWTTCTTTTGTKTTTTAGATGTGTCACGTTACTCTGAT[A/T]AATATCAAACTGGAGAGCCAAAGAAYAACACCATTGAAWGGAGTCCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013666 Nonsense 169 218 7 8
ENSDART00000132660 Nonsense 172 221 7 8
Genomic Location (Zv9):
Chromosome 19 (position 25035313)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24965425
GRCz11 19 24549648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAGAAGTGCATTCTGAGGAAGAGGAGGATGAGGGGAAGAAGAAGAAA[C/T]AGAATGATGACGAAGAGGAGGAGCCAGAAGTGGAGGAAGATTATGATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link