zgc:100832

Ensembl ID:
ENSDARG00000012035
ZFIN ID:
ZDB-GENE-040801-53
Description:
hypothetical protein LOC445148 [Source:RefSeq peptide;Acc:NP_001003542]
Human Orthologues:
FBXO44, FBXO6
Human Descriptions:
F-box protein 44 [Source:HGNC Symbol;Acc:24847]
F-box protein 6 [Source:HGNC Symbol;Acc:13585]
Mouse Orthologues:
Fbxo44, Fbxo6
Mouse Descriptions:
F-box protein 44 Gene [Source:MGI Symbol;Acc:MGI:1354744]
F-box protein 6 Gene [Source:MGI Symbol;Acc:MGI:1354743]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37655 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031527 Nonsense 90 247 3 7
ENSDART00000142789 Nonsense 90 162 4 6
ENSDART00000143424 Nonsense 90 247 3 6
Genomic Location (Zv9):
Chromosome 23 (position 16991296)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16894235
GRCz11 23 16820578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGATAAATTCTTTTTTCTGATGTTCTTATTAGATAAATTTCAAGGATGG[G/T]AGATTGTCGAGAATGGAGGTGACCTCTGGAGCATCGAAAACAGTAGGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link