
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:100832
- Ensembl ID:
- ENSDARG00000012035
- ZFIN ID:
- ZDB-GENE-040801-53
- Description:
- hypothetical protein LOC445148 [Source:RefSeq peptide;Acc:NP_001003542]
- Human Orthologues:
- FBXO44, FBXO6
- Human Descriptions:
- F-box protein 44 [Source:HGNC Symbol;Acc:24847]
- F-box protein 6 [Source:HGNC Symbol;Acc:13585]
- Mouse Orthologues:
- Fbxo44, Fbxo6
- Mouse Descriptions:
- F-box protein 44 Gene [Source:MGI Symbol;Acc:MGI:1354744]
- F-box protein 6 Gene [Source:MGI Symbol;Acc:MGI:1354743]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37655 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa37655
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031527 | Nonsense | 90 | 247 | 3 | 7 |
ENSDART00000142789 | Nonsense | 90 | 162 | 4 | 6 |
ENSDART00000143424 | Nonsense | 90 | 247 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 23 (position 16991296)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 16894235 GRCz11 23 16820578 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGATAAATTCTTTTTTCTGATGTTCTTATTAGATAAATTTCAAGGATGG[G/T]AGATTGTCGAGAATGGAGGTGACCTCTGGAGCATCGAAAACAGTAGGACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: