zgc:136844

Ensembl ID:
ENSDARG00000012005
ZFIN ID:
ZDB-GENE-060616-319
Description:
hypothetical protein LOC724012 [Source:RefSeq peptide;Acc:NP_001038782]
Human Orthologue:
AC091196.1
Human Description:
Mps one binder kinase activator-like 2 [Source:UniProtKB/Swiss-Prot;Acc:Q70IA6]
Mouse Orthologue:
2700078K21Rik
Mouse Description:
RIKEN cDNA 2700078K21 gene Gene [Source:MGI Symbol;Acc:MGI:1919891]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15110 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15110
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046780 Nonsense 212 218 5 5
ENSDART00000126916 Nonsense 213 219 5 5
ENSDART00000131349   None 108 None 3
ENSDART00000145722 Nonsense 209 215 4 4
Genomic Location (Zv9):
Chromosome 18 (position 48893456)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50040856
GRCz11 18 50037336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAATAATGGACGACCTGACGGAGGCGCTGTGCACACCTCTTCCGCCA[C/T]AGAACCAYGTGACAGAGAGATGAGCCCCCGGGGCCCGAACGCACAGCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link