zgc:103750

Ensembl ID:
ENSDARG00000011998
ZFIN ID:
ZDB-GENE-041212-58
Description:
phakinin [Source:RefSeq peptide;Acc:NP_001008633]
Human Orthologue:
BFSP2
Human Description:
beaded filament structural protein 2, phakinin [Source:HGNC Symbol;Acc:1041]
Mouse Orthologue:
Bfsp2
Mouse Description:
beaded filament structural protein 2, phakinin Gene [Source:MGI Symbol;Acc:MGI:1333828]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6852 Nonsense Mutation detected in F1 DNA During 2018
sa39864 Nonsense Mutation detected in F1 DNA During 2018
sa19801 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004712 Nonsense 7 438 1 7
ENSDART00000125889 Nonsense 7 441 1 8
Genomic Location (Zv9):
Chromosome 2 (position 32486645)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32785552
GRCz11 2 32768770
KASP Assay ID:
554-5257.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCTGTCACTTCAAAAGCATCAGGACAGGAATGCCTCTTCCAAGACGC[C/T]GATCCTCCTTCCTGGGCCAGGGTGCAGCGGAGCGTCCTGGCAGTGTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004712 Nonsense 275 438 4 7
ENSDART00000125889 Nonsense 275 441 4 8
Genomic Location (Zv9):
Chromosome 2 (position 32484181)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32783088
GRCz11 2 32766306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGGAGAGGGTGGTGGAGAAGAACCGTGCAGAGACGTATGCCTACTTT[G/T]AGTGCAAGGTAAGCCACCGTCTCAAAGATATTTATTAGAAAAACTTGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004712   428 438 7 7
ENSDART00000125889 Essential Splice Site 428 441 None 8
Genomic Location (Zv9):
Chromosome 2 (position 32479291)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32778198
GRCz11 2 32761416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCCACACCTTCCACATCTGGACAACAGAGCTGTGCACAGACTGACGG[T/A]ACTCTTTTAACAGAATATTATAACACAGAATAACTGTAAAATGATCAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link