
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dlx4a
- Ensembl ID:
- ENSDARG00000011956
- ZFIN ID:
- ZDB-GENE-980526-73
- Description:
- Homeobox protein Dlx4a [Source:UniProtKB/Swiss-Prot;Acc:Q98879]
- Human Orthologues:
- DLX1, DLX6
- Human Descriptions:
- distal-less homeobox 1 [Source:HGNC Symbol;Acc:2914]
- distal-less homeobox 6 [Source:HGNC Symbol;Acc:2919]
- Mouse Orthologues:
- Dlx1, Dlx6
- Mouse Descriptions:
- distal-less homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:94901]
- distal-less homeobox 6 Gene [Source:MGI Symbol;Acc:MGI:101927]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40108 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa2124 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa40108
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000007073 | Nonsense | 55 | 250 | 1 | 4 |
ENSDART00000133457 | Nonsense | 55 | 250 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 3 (position 34755711)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 34540907 GRCz11 3 34670415 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACGCGCACTATCCGGTGCACGGTTTGCATCAAGGCGCGCATTCGCAATA[C/A]GACGCGGCCTTCTCTCCTGGCGCTGCGTCTTACAGCCGTCCACTCGCTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2124
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000007073 | Nonsense | 228 | 250 | 3 | 4 |
ENSDART00000133457 | Nonsense | 228 | 250 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 3 (position 34766381)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 34551577 GRCz11 3 34681085 - KASP Assay ID:
- 554-3326.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGGATGTTTCCATGCCCAGCAAAGGTGCTCCCATCCACTCTGGAGGATA[T/A]ATGAACTCTTTCGGACACTGGTACTCGGGTCATCATCAAGACCCAATGGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: