
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-114g7.2
- Ensembl ID:
- ENSDARG00000011955
- ZFIN ID:
- ZDB-GENE-060503-803
- Description:
- Novel protein similar to vertebrate chaperone, ABC1 activity of bc1 complex like (S. pombe) (CABC1)
- Human Orthologue:
- ADCK4
- Human Description:
- aarF domain containing kinase 4 [Source:HGNC Symbol;Acc:19041]
- Mouse Orthologue:
- Adck4
- Mouse Description:
- aarF domain containing kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1924139]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35821 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa24977 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa32019 | Nonsense | Available for shipment | Available now |
sa6367 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35821
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006829 | Essential Splice Site | 1 | 624 | None | 15 |
ENSDART00000140621 | Essential Splice Site | 1 | 623 | None | 15 |
ENSDART00000006829 | Essential Splice Site | 1 | 624 | None | 15 |
ENSDART00000140621 | Essential Splice Site | 1 | 623 | None | 15 |
- Genomic Location (Zv9):
- Chromosome 15 (position 13608057)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 14653654 GRCz11 15 14589611 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAGGACACTTCATAGAGACGCTGAGGAGACTCTAAACTCTCAATACGAG[T/A]AAGTAACGATAACATTACTGGTAGGAAACTACACTGCTGTGATAATTTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24977
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006829 | Essential Splice Site | 1 | 624 | None | 15 |
ENSDART00000140621 | Essential Splice Site | 1 | 623 | None | 15 |
ENSDART00000006829 | Essential Splice Site | 1 | 624 | None | 15 |
ENSDART00000140621 | Essential Splice Site | 1 | 623 | None | 15 |
- Genomic Location (Zv9):
- Chromosome 15 (position 13608057)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 14653654 GRCz11 15 14589611 - KASP Assay ID:
- 554-7318.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAGGACACTTCATAGAGACGCTGAGGAGACTCTAAACTCTCAATACGAG[T/A]AAGTAACGATAACATTACTGGTAGGAAACTACACTGCTGTGATAATTTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32019
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006829 | Nonsense | 85 | 624 | 3 | 15 |
ENSDART00000140621 | Nonsense | 85 | 623 | 3 | 15 |
- Genomic Location (Zv9):
- Chromosome 15 (position 13626520)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 14635191 GRCz11 15 14571148 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTGGAATTGAGAAGTGGGAGGAGATGGACCTGGATGAAGCTGCAAAGTG[G/A]TCGGTCGCCTCAGAAATGCCACCAGACTTTTCCAGTAAAGACGGAAGGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6367
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006829 | Nonsense | 316 | 624 | 8 | 15 |
ENSDART00000140621 | Nonsense | 316 | 623 | 8 | 15 |
- Genomic Location (Zv9):
- Chromosome 15 (position 13633410)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 14628301 GRCz11 15 14564258 - KASP Assay ID:
- 554-5016.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAAACTCTCATCAWTTGAGGAAAAGCCTTTTGCTGCTGCCTCCATTGGA[C/T]AAGTTCATCATGGAGTTTTGCCTGRTGGGAAGGAAATCGCTATGAAGATA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: