zgc:91821

Ensembl ID:
ENSDARG00000011926
ZFIN ID:
ZDB-GENE-040704-49
Description:
tubulin polyglutamylase complex subunit 2 [Source:RefSeq peptide;Acc:NP_001002208]
Human Orthologue:
C18orf10
Human Description:
chromosome 18 open reading frame 10 [Source:HGNC Symbol;Acc:24561]
Mouse Orthologue:
5730494M16Rik
Mouse Description:
RIKEN cDNA 5730494M16 gene Gene [Source:MGI Symbol;Acc:MGI:1913898]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10459 Essential Splice Site Available for shipment Available now
sa23875 Essential Splice Site Available for shipment Available now
sa23874 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031658   None 290 None 7
ENSDART00000131607   None 92 None 6
ENSDART00000139145 Essential Splice Site None 218 1 7
ENSDART00000142644   None 91 None 6
Genomic Location (Zv9):
Chromosome 21 (position 10454622)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11937985
GRCz11 21 12030613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACTGTYGGTRTGCCTCCAGGAACAGGGTTGGGAAACATAGACCRTAT[G/A]TATTTATAAATTKACATAGTCYTTGTAAARTTTGTCATTGTATTTTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031658   None 290 None 7
ENSDART00000131607 Essential Splice Site 55 92 2 6
ENSDART00000139145   None 218 None 7
ENSDART00000142644 Essential Splice Site 55 91 2 6
Genomic Location (Zv9):
Chromosome 21 (position 10454371)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11937734
GRCz11 21 12030362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCCCCTGCAGAAAAGAGATGCCTTCTCTCCTGGGAGCAGGTATGGAG[G/A]TACTTTTGTATCACTGTGCATAATTTCGAATCAGAGATCTGACGAGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031658   84 290 4 7
ENSDART00000131607 Nonsense 87 92 4 6
ENSDART00000139145   12 218 4 7
ENSDART00000142644   None 91 4 6
Genomic Location (Zv9):
Chromosome 21 (position 10453290)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11936653
GRCz11 21 12029281
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATAAGCTTTTACTCTAAAAATCAATGTTTTGTGTCCTACAGATGAAGT[G/A]GTTCCAGTGGGTTGCATGATGATCAACAACGTTGCTCAATTACGCCCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link