txnl1

Ensembl ID:
ENSDARG00000011921
ZFIN ID:
ZDB-GENE-040426-701
Description:
thioredoxin-like 1 [Source:RefSeq peptide;Acc:NP_957432]
Human Orthologue:
TXNL1
Human Description:
thioredoxin-like 1 [Source:HGNC Symbol;Acc:12436]
Mouse Orthologue:
Txnl1
Mouse Description:
thioredoxin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1860078]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37196 Nonsense Mutation detected in F1 DNA During 2018
sa43558 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006419 Nonsense 23 289 1 9
ENSDART00000133976 Nonsense 23 289 1 8
Genomic Location (Zv9):
Chromosome 21 (position 1107924)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 812712
GRCz11 21 929226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCGGGAATGACTCGGATTTCCAGGCGGAGCTCAGCGGAGCGGGTTCC[A/T]GACTGACCGTGGTGAAGTTCACCATGAGCGGGTGAGTGAGCGAGAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006419 Nonsense 271 289 7 9
ENSDART00000133976 Nonsense 271 289 7 8
Genomic Location (Zv9):
Chromosome 21 (position 1118029)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 822817
GRCz11 21 919121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGGAGACGACAAAAATCAACTATTTGACGTTTATCGGGACTCCAGTG[C/T]AGGCCACGAACATGAACGACTTCAAACGGGTCTGTACAGGAGGACGATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link