zgc:112211

Ensembl ID:
ENSDARG00000011863
ZFIN ID:
ZDB-GENE-050522-216
Description:
hypothetical protein LOC553690 [Source:RefSeq peptide;Acc:NP_001018501]
Human Orthologue:
PTK7
Human Description:
PTK7 protein tyrosine kinase 7 [Source:HGNC Symbol;Acc:9618]
Mouse Orthologue:
Ptk7
Mouse Description:
PTK7 protein tyrosine kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1918711]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10484 Nonsense Available for shipment Available now
sa37574 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37573 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098461 Nonsense 470 1061 9 20
Genomic Location (Zv9):
Chromosome 22 (position 41320533)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38424666
GRCz11 22 38410952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAAGCTCTTCTCCAATGGGACTCTTCGCATAAATAACGTGGAGGTGTA[C/A]GACGGCCACATGTACAGCTGCGAGAGCAGAACGGAGGCWGGAAGAGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098461 Essential Splice Site 872 1061 17 20
Genomic Location (Zv9):
Chromosome 22 (position 41308146)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38412279
GRCz11 22 38398565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTCTGAGCTGCATTTATCACTGTTTGATTGTGCTGTGTGTGCTTTTC[A/T]GGGTGATCTGAAGCAGTATCTGAGAGTCTCCAAGAGCAAAGATGAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098461 Essential Splice Site 1009 1061 19 20
Genomic Location (Zv9):
Chromosome 22 (position 41305710)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38409843
GRCz11 22 38396129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGGGGAAATGCCCTACGCTGACCTTGCTGATGATAAAGTGCTGGAAGG[T/C]GAGAAAGAGGATCCAAACATGCTATGACTTTCCAAAAACAATCATTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link