si:dkey-71c4.3

Ensembl ID:
ENSDARG00000011855
ZFIN ID:
ZDB-GENE-081105-101
Description:
Novel protein similar to H.sapiens AAK1, AP2 associated kinase 1 (AAK1) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
AAK1
Human Description:
AP2 associated kinase 1 [Source:HGNC Symbol;Acc:19679]
Mouse Orthologue:
Aak1
Mouse Description:
AP2 associated kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1098687]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13225 Nonsense Available for shipment Available now
sa21387 Nonsense Available for shipment Available now
sa34493 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7158 Nonsense Mutation detected in F1 DNA During 2018
sa31683 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008058 Nonsense 41 569 1 13

The following transcripts of ENSDARG00000011855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 51226474)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 48977518
GRCz11 8 48966287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGCGGGCTCCGGTGCMTTCATCGGACGCGTTTTCTCCATCGGACGCTA[T/A]CAGGTGACCGTGGAGGAGACCGTGGCCGAGGGTGAGTTGTTCATAGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008058 Nonsense 139 569 4 13

The following transcripts of ENSDARG00000011855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 51258301)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49009345
GRCz11 8 48998114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTCTGCTAATGCAGGCGGGCAGGTTGTGAACCTGATGAACCAGCGTT[T/A]GCAGACGGGCTTCAGTGAGTCGGAAGTGCTGCAGATCTTCTGTGACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008058 Essential Splice Site 243 569 6 13

The following transcripts of ENSDARG00000011855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 51260256)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49011300
GRCz11 8 49000069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCAATCTCTACGGAGGCATGGTCATCACTACTAAAGCAGATATATGG[G/T]TGAGTCAAGTCAAATAATCATTTACCTGCGGTGACAACAGGGTATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008058 Nonsense 253 569 7 13

The following transcripts of ENSDARG00000011855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 51262294)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49013338
GRCz11 8 49002107
KASP Assay ID:
554-4630.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTATGTTTGTGTCYTCAGGCTTTAGGCTGCTTGTTGTATAAGTTGTG[T/A]TATTTCACRTTGCCGTTTGGAGAGAGTCAGGTGGCTATCTGTGACGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008058 Essential Splice Site 402 569 10 13

The following transcripts of ENSDARG00000011855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 51266939)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49017983
GRCz11 8 49006752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCTCGCAAAAGACCCAGTGCACCTCCAGGACCCAGCCAACCAATCAG[T/C]GAGTGTTGTGTCTTTATGCTCAATCTCTCTCTCTCTCTTGCTCTCTCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link