zgc:100846

Ensembl ID:
ENSDARG00000011837
ZFIN ID:
ZDB-GENE-040801-47
Description:
hypothetical protein LOC402895 [Source:RefSeq peptide;Acc:NP_991166]
Human Orthologue:
C9orf72
Human Description:
chromosome 9 open reading frame 72 [Source:HGNC Symbol;Acc:28337]
Mouse Orthologue:
3110043O21Rik
Mouse Description:
RIKEN cDNA 3110043O21 gene Gene [Source:MGI Symbol;Acc:MGI:1920455]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30667 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015127 Essential Splice Site 227 462 5 10
ENSDART00000125180 Essential Splice Site 227 462 4 9
ENSDART00000126136 Essential Splice Site 227 326 5 11
Genomic Location (Zv9):
Chromosome 13 (position 12634813)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12633181
GRCz11 13 12765656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGCGGCTGTTCCATGGTGGTTGGCAGCAATCCTGAGAAAGTCAATAAG[G/A]TGCACATTCCTACCCCGACATTCTTAACATTCACACCCGAGTATGTTAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link