zgc:171928

Ensembl ID:
ENSDARG00000011809
ZFIN ID:
ZDB-GENE-081022-3
Description:
Zgc:171928 protein [Source:UniProtKB/TrEMBL;Acc:A7E2L2]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24396 Nonsense Available for shipment Available now
sa5982 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037315 Nonsense 264 1214 5 23
ENSDART00000136707 Nonsense 264 1227 6 24

The following transcripts of ENSDARG00000011809 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 39635523)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39597088
GRCz11 23 39489999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAAACAAGAGGCTCAGGTGCAGGAGATCAGCGGTGTGGCCCGAATTTA[C/A]AACCAGCAGTTTTTCCAGGCTCTTCAGTCTGAGATTGGTAGAGACTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037315 Nonsense 891 1214 17 23
ENSDART00000136707 Nonsense 904 1227 18 24

The following transcripts of ENSDARG00000011809 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 39662113)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39623678
GRCz11 23 39516589
KASP Assay ID:
554-3763.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MWGAGCAGATTCCTGAGGAGCCCAAACCCAAACCGTCCCTGCGCAAACTC[C/T]AGCAGAGCGAAGAGGAGAAGGTGGATCTGTTGAGCCAGGATTCAGACTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link