wars2

Ensembl ID:
ENSDARG00000011801
ZFIN ID:
ZDB-GENE-050306-26
Description:
tryptophanyl-tRNA synthetase, mitochondrial [Source:RefSeq peptide;Acc:NP_001013341]
Human Orthologue:
WARS2
Human Description:
tryptophanyl tRNA synthetase 2, mitochondrial [Source:HGNC Symbol;Acc:12730]
Mouse Orthologue:
Wars2
Mouse Description:
tryptophanyl tRNA synthetase 2 (mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:1917810]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41400 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41399 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018570 Essential Splice Site 121 364 2 6
Genomic Location (Zv9):
Chromosome 9 (position 22118048)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21273834
GRCz11 9 21084703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTGTGGAATCGACCCGACACGCTCCATACTTTTCCAGCAGTCTCAAG[T/C]GAGTCCTACATTAAAGTCCCCATGAACTGGAAGCTGCGACCTTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018570 Nonsense 204 364 5 6
Genomic Location (Zv9):
Chromosome 9 (position 22109561)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21265347
GRCz11 9 21076216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCACTTGGAGCTCGCCCAGGACTTGGCCCGTATCTTTAACAACCAGTA[C/A]GGAGAGTTCTTCCCTGAGCCTCGTGCCCTGCTCAGTATGTTTGGACGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Waist-hip ratio: Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link