zgc:55466

Ensembl ID:
ENSDARG00000011764
ZFIN ID:
ZDB-GENE-030131-6224
Description:
hypothetical protein LOC334292 [Source:RefSeq peptide;Acc:NP_956177]
Human Orthologue:
C12orf11
Human Description:
chromosome 12 open reading frame 11 [Source:HGNC Symbol;Acc:20174]
Mouse Orthologue:
4933424B01Rik
Mouse Description:
RIKEN cDNA 4933424B01 gene Gene [Source:MGI Symbol;Acc:MGI:1918427]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40288 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017572 Essential Splice Site 358 704 11 17
Genomic Location (Zv9):
Chromosome 4 (position 19429956)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20773291
GRCz11 4 20494266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATAAATATTATACGTTCATGTACTTTTCCTTTTGTCTGTTGTCTTCCC[A/G]GGTCGCTCTGTGCTACTAGAACAGCCTCGGAAGTCAGGGTCAAAGGTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link