zgc:56556

Ensembl ID:
ENSDARG00000011723
ZFIN ID:
ZDB-GENE-040426-1078
Description:
UPF0489 protein C5orf22 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7SZF1]
Human Orthologue:
C5orf22
Human Description:
chromosome 5 open reading frame 22 [Source:HGNC Symbol;Acc:25639]
Mouse Orthologue:
6030458C11Rik
Mouse Description:
RIKEN cDNA 6030458C11 gene Gene [Source:MGI Symbol;Acc:MGI:1925127]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38336 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11848 Essential Splice Site Available for shipment Available now
sa12758 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020367 Essential Splice Site 344 439 7 9

The following transcripts of ENSDARG00000011723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 28134196)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 28310681
GRCz11 2 27966317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTGTACACAGTCTTAAGAATCGACCATCACCTCCGGACTATGAAATG[G/T]TGTGTTTGTTTTATATTTTAGTGGATATTTTAATCATGCTTTTAGTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020367 Essential Splice Site 344 439 None 9

The following transcripts of ENSDARG00000011723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 28134195)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 28310680
GRCz11 2 27966316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGTRCACAGTCTTAAGAATCGACCATCACCTCCGGACTATGAAATGG[T/G]GTGTTTGTTTTATATTTTAGTGGATATTTTAATCATGCTTTTAGTGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020367 Nonsense 397 439 9 9

The following transcripts of ENSDARG00000011723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 28125976)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 28302461
GRCz11 2 27958097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTTCCTGAACTTCTATTTGTTCTTGTCAGATCCAGTTTGGATGAGTA[T/A]TGTCCAGCTGAACAAGTGGATTCCATCCAGATCAGARTGCTGAAYATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link