si:zfos-979f1.2

Ensembl ID:
ENSDARG00000011652
ZFIN ID:
ZDB-GENE-091204-441
Human Orthologues:
RANBP2, RGPD1, RGPD2, RGPD3, RGPD4, RGPD5, RGPD6, RGPD8
Human Descriptions:
RAN binding protein 2 [Source:HGNC Symbol;Acc:9848]
RANBP2-like and GRIP domain containing 1 [Source:HGNC Symbol;Acc:32414]
RANBP2-like and GRIP domain containing 2 [Source:HGNC Symbol;Acc:32415]
RANBP2-like and GRIP domain containing 3 [Source:HGNC Symbol;Acc:32416]
RANBP2-like and GRIP domain containing 4 [Source:HGNC Symbol;Acc:32417]
RANBP2-like and GRIP domain containing 5 [Source:HGNC Symbol;Acc:32418]
RANBP2-like and GRIP domain containing 6 [Source:HGNC Symbol;Acc:32419]
RANBP2-like and GRIP domain containing 8 [Source:HGNC Symbol;Acc:9849]
Mouse Orthologue:
Ranbp2
Mouse Description:
RAN binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:894323]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa422 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018260 Essential Splice Site 319 637 4 8
ENSDART00000137996   None 345 None 4
Genomic Location (Zv9):
Chromosome 9 (position 3158418)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3153890
GRCz11 9 3159910
KASP Assay ID:
554-0320.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACTGGAGAATTTCTGTAGAGAAGACATTGACAAGATGTCTGGCCGAG[G/A]TAAAGAGTCCGACAGATATTTTTTCTTATAAATGCGTCTTGCATCAATGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link