sox5

Ensembl ID:
ENSDARG00000011582
ZFIN ID:
ZDB-GENE-000607-13
Description:
transcription factor SOX-5 [Source:RefSeq peptide;Acc:NP_001028757]
Human Orthologue:
SOX5
Human Description:
SRY (sex determining region Y)-box 5 [Source:HGNC Symbol;Acc:11201]
Mouse Orthologue:
Sox5
Mouse Description:
SRY-box containing gene 5 Gene [Source:MGI Symbol;Acc:MGI:98367]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33440 Nonsense Mutation detected in F1 DNA During 2018
sa18782 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33439 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006737 Nonsense 223 759 5 15
ENSDART00000134595 Nonsense 221 757 5 15
Genomic Location (Zv9):
Chromosome 4 (position 16085611)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17028451
GRCz11 4 17017427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAGAGCAGTTACTGGCTGCCCACGAGGAGCAGAAGAAACTGGCTGCTT[C/A]ACAGATTGAAAAACAACGCCAGCAAATGGAGTTAGCAAAACAGCAACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006737 Essential Splice Site 443 759 11 15
ENSDART00000134595 Essential Splice Site 441 757 11 15
Genomic Location (Zv9):
Chromosome 4 (position 16059924)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17002764
GRCz11 4 16991740
KASP Assay ID:
2259-4783.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGTTCCTTATTGAAAGTTGTGTCTTATTCATACATGTCAATTCTTTC[A/G]GACCTGTTATCATCCATCACCTCTGCCGGCTACCTGAATGACCATGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006737 Essential Splice Site 592 759 13 15
ENSDART00000134595 Essential Splice Site 590 757 13 15
Genomic Location (Zv9):
Chromosome 4 (position 16056234)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16999074
GRCz11 4 16988050
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCAGGCCTTCCCTGACATGCATAACTCAAATATCAGCAAGATCCTCG[G/A]TGAGAATCAGGGCTAGTAAATCTCTTCAGCTCCTTATCTAACCACTACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link