atp5f1

Ensembl ID:
ENSDARG00000011553
ZFIN ID:
ZDB-GENE-041010-33
Description:
ATP synthase subunit b, mitochondrial [Source:RefSeq peptide;Acc:NP_001005960]
Human Orthologue:
ATP5F1
Human Description:
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1 [Source:HGNC Symbol;Acc:840]
Mouse Orthologue:
Atp5f1
Mouse Description:
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34405 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009682   None 252 None 7
ENSDART00000131616 Essential Splice Site None 252 2 8

The following transcripts of ENSDARG00000011553 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26189195)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25317113
GRCz11 8 25336252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTAATGGCAACGACTTGCAAGTGTCGACGCTTTTATTTTTAATTATT[A/G]GGCGCTGTGGACTTAAGAGTCTCCCGGATGTGGCAGACGCTGGTTCCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link