
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-212o1.2
- Ensembl ID:
- ENSDARG00000011498
- ZFIN ID:
- ZDB-GENE-041111-310
- Description:
- hypothetical protein LOC492735 [Source:RefSeq peptide;Acc:NP_001073633]
- Mouse Orthologue:
- Tmem189
- Mouse Description:
- transmembrane protein 189 Gene [Source:MGI Symbol;Acc:MGI:2142624]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32200 | Nonsense | Available for shipment | Available now |
sa23279 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32200
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005027 | Nonsense | 238 | 288 | 6 | 7 |
ENSDART00000146898 | None | 144 | None | 5 | |
ENSDART00000147797 | Nonsense | 233 | 283 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 17707980)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 18059746 GRCz11 18 18048812 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGACTGCCACCTAGTGCTGCCCCGCAAGCACCACCGGATCCATCATGTGT[C/A]GCCGCATGAGACTTACTACTGCATCACTACAGGTACACTACTGATAGGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23279
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005027 | Nonsense | 251 | 288 | 7 | 7 |
ENSDART00000146898 | None | 144 | None | 5 | |
ENSDART00000147797 | Nonsense | 246 | 283 | 6 | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 17718316)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 18070082 GRCz11 18 18059148 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCATGACACCTCTGCGTCTCTGTCTCCATCCTTCTCTCCCTCAGGCTGGT[T/A]GAACTATCCGCTGGACAGAGTGGGCTTTTGGCGGACAATGGAGTGGCTCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: