zgc:77816

Ensembl ID:
ENSDARG00000011376
ZFIN ID:
ZDB-GENE-040426-1884
Description:
hypothetical protein LOC393843 [Source:RefSeq peptide;Acc:NP_957163]
Human Orthologues:
DNASE1L1, DNASE1L3
Human Descriptions:
deoxyribonuclease I-like 1 [Source:HGNC Symbol;Acc:2957]
deoxyribonuclease I-like 3 [Source:HGNC Symbol;Acc:2959]
Mouse Orthologues:
Dnase1l1, Dnase1l3
Mouse Descriptions:
deoxyribonuclease 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:109628]
deoxyribonuclease 1-like 3 Gene [Source:MGI Symbol;Acc:MGI:1314633]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa754 Essential Splice Site Available for shipment Available now
hu7885 Essential Splice Site Available for shipment Available now
sa607 Nonsense F2 line generated During 2018
sa17900 Nonsense Available for shipment Available now
sa32369 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019854 Essential Splice Site None 282 2 9
ENSDART00000121876   None 327 None 13
ENSDART00000131308   None 216 2 7
ENSDART00000133241   None 158 2 6
ENSDART00000138102   None 221 None 8
ENSDART00000140680 Essential Splice Site None 163 2 6
ENSDART00000019854 Essential Splice Site None 282 2 9
ENSDART00000121876   None 327 None 13
ENSDART00000131308   None 216 2 7
ENSDART00000133241   None 158 2 6
ENSDART00000138102   None 221 None 8
ENSDART00000140680 Essential Splice Site None 163 2 6
Genomic Location (Zv9):
Chromosome 22 (position 5612282)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5658349
GRCz11 22 5688195
KASP Assay ID:
554-0661.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAGTTGTTTTTTTCTTTTCACAAAAYGCCGCCTTGTTTGTGGTTTTA[G/C]ATTTTATTTAAGGTCGACAACATGAAGATCGCATCTTTTAACATCCAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019854 Essential Splice Site None 282 2 9
ENSDART00000121876   None 327 None 13
ENSDART00000131308   None 216 2 7
ENSDART00000133241   None 158 2 6
ENSDART00000138102   None 221 None 8
ENSDART00000140680 Essential Splice Site None 163 2 6
ENSDART00000019854 Essential Splice Site None 282 2 9
ENSDART00000121876   None 327 None 13
ENSDART00000131308   None 216 2 7
ENSDART00000133241   None 158 2 6
ENSDART00000138102   None 221 None 8
ENSDART00000140680 Essential Splice Site None 163 2 6
Genomic Location (Zv9):
Chromosome 22 (position 5612282)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5658349
GRCz11 22 5688195
KASP Assay ID:
554-0661.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAGTTGNTTTTTTYTTTTCASAAAAYGCYGCCTTGTTTGTGGTTTTA[G/C]ATTTTATTTAAGGTCGACAACATGAAGATCGCATCTTTTAACATCCAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa607
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019854 Nonsense 99 282 5 9
ENSDART00000121876 Nonsense 99 327 4 13
ENSDART00000131308 Nonsense 99 216 5 7
ENSDART00000133241 Nonsense 99 158 5 6
ENSDART00000138102 Nonsense 99 221 5 8
ENSDART00000140680 Nonsense 99 163 5 6
Genomic Location (Zv9):
Chromosome 22 (position 5614704)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5660771
GRCz11 22 5690617
KASP Assay ID:
554-0517.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGCTCAYATCYAACAGAGAAGCTGATGCTAAACTGCTCAACACATAC[C/T]AATATGAAGACAACCAAGTGGGTGAYGAAGATGCTTTCTCTCGGGAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019854 Nonsense 214 282 7 9
ENSDART00000121876 Nonsense 214 327 6 13
ENSDART00000131308 Nonsense 214 216 7 7
ENSDART00000133241   None 158 None 6
ENSDART00000138102 Nonsense 214 221 7 8
ENSDART00000140680   None 163 None 6
Genomic Location (Zv9):
Chromosome 22 (position 5619307)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5665374
GRCz11 22 5695220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGGAGATGAYGTTGACACCACCGTCAAAACGACCAAYGACAACACCTA[C/A]GACAGGTGAGGAGCATCAATAAACWTTTGCTSTGCRGTTCTGTTTAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019854 Nonsense 264 282 9 9
ENSDART00000121876 Nonsense 264 327 8 13
ENSDART00000131308   None 216 None 7
ENSDART00000133241   None 158 None 6
ENSDART00000138102   None 221 None 8
ENSDART00000140680   None 163 None 6
Genomic Location (Zv9):
Chromosome 22 (position 5622295)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5668362
GRCz11 22 5698208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGGCTCTGGATGTCAGTGACCATTATCCAGTGGAGGTGACTCTAAAG[A/T]AGAAACCTGCAGCAAAGGCCACCGGCAAAACCAAGAAACCACAGAAACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link