zgc:64106

Ensembl ID:
ENSDARG00000011371
ZFIN ID:
ZDB-GENE-040426-1370
Description:
hypothetical protein LOC393348 [Source:RefSeq peptide;Acc:NP_956671]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11382 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024248 Nonsense 202 309 4 6
ENSDART00000143537 Nonsense 216 323 4 6

The following transcripts of ENSDARG00000011371 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10415502)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11898865
GRCz11 21 11991493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGGGTGAATCGTGTGTACAACCACACCAAGCTGCACAATGTCATCTG[G/A]ACCAACGAGTTGGCACGCAGGCTTCAGGGCACAGGTTCGCAAACTAAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link