zgc:112418

Ensembl ID:
ENSDARG00000011326
ZFIN ID:
ZDB-GENE-050522-311
Description:
ankyrin repeat domain-containing protein 45 [Source:RefSeq peptide;Acc:NP_001018606]
Human Orthologue:
ANKRD45
Human Description:
ankyrin repeat domain 45 [Source:HGNC Symbol;Acc:24786]
Mouse Orthologue:
Ankrd45
Mouse Description:
ankyrin repeat domain 45 Gene [Source:MGI Symbol;Acc:MGI:1921094]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39872 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002094 Nonsense 22 224 1 5
ENSDART00000135843   None 180 None 8
Genomic Location (Zv9):
Chromosome 2 (position 35448962)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35745672
GRCz11 2 35728129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGAAAACTGTACTTTTATGTGCATTAGATGACGATTTAGAGGGACTT[A/T]AAGGTATTTTGGAACGCACGTTTACCGACGATGCTGCACAGTCAGAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link