stk3

Ensembl ID:
ENSDARG00000011312
ZFIN ID:
ZDB-GENE-030131-2845
Description:
Serine/threonine-protein kinase 3 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUQ3]
Human Orthologue:
STK3
Human Description:
serine/threonine kinase 3 [Source:HGNC Symbol;Acc:11406]
Mouse Orthologue:
Stk3
Mouse Description:
serine/threonine kinase 3 (Ste20, yeast homolog) Gene [Source:MGI Symbol;Acc:MGI:1928487]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17740 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008698 Nonsense 80 492 4 11

The following transcripts of ENSDARG00000011312 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 34183538)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 33220954
GRCz11 19 32808074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGAACKTAACAAYATTTTCATTCCTCRTTGTGTTTTAAYAGCCCATA[T/A]GTGGTGAAGTACTATGGCAGCTATTTCAAAAACACAGATCTGTGGATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link