zgc:73238

Ensembl ID:
ENSDARG00000011272
ZFIN ID:
ZDB-GENE-040426-1726
Description:
hypothetical protein LOC393731 [Source:RefSeq peptide;Acc:NP_957052]
Human Orthologue:
C6orf125
Human Description:
chromosome 6 open reading frame 125 [Source:HGNC Symbol;Acc:21237]
Mouse Orthologue:
2900010M23Rik
Mouse Description:
RIKEN cDNA 2900010M23 gene Gene [Source:MGI Symbol;Acc:MGI:1914517]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9189 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004075 Essential Splice Site 46 129 1 4
Genomic Location (Zv9):
Chromosome 6 (position 40504399)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40575999
GRCz11 6 40573535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTACGCCAAAGAGTCGCTAGTGCTTTCCGGGAGGGSGAAAATACACAGG[T/C]ATGTACTGCACCATTTATCCTTGCTGACATTCAAAGTCAAATCTTTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link