zgc:136398

Ensembl ID:
ENSDARG00000011246
ZFIN ID:
ZDB-GENE-060623-10
Description:
KRR1 small subunit processome component homolog [Source:RefSeq peptide;Acc:NP_001038790]
Human Orthologue:
KRR1
Human Description:
KRR1, small subunit (SSU) processome component, homolog (yeast) [Source:HGNC Symbol;Acc:5176]
Mouse Orthologue:
Krr1
Mouse Description:
KRR1, small subunit (SSU) processome component, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1289

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12957 Essential Splice Site Available for shipment Available now
sa25271 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125815 Essential Splice Site 104 398 3 10
Genomic Location (Zv9):
Chromosome 4 (position 2123695)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2413402
GRCz11 4 2262715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAATTAGATTTTTTGTCTCATTTCTCTNNCTCTTCTGCTGCTGTGTA[G/A]TTCATCAATGCCACACTGGACCTGATTGAGGGCAGTATGACGGTGAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125815 Nonsense 330 398 9 10
Genomic Location (Zv9):
Chromosome 4 (position 2120893)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2410600
GRCz11 4 2259913
KASP Assay ID:
554-7442.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACGCATGCTTTTTTTTTTTAGGTTAAGCAGGCTGAGGCTTTATCTAAA[C/T]GACAAGAGGAGCGAAAGAAAGCCTTCGTTCCTCCCAAAGAGAAAACAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link