
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
akt2
- Ensembl ID:
- ENSDARG00000011219
- ZFIN ID:
- ZDB-GENE-031007-5
- Description:
- RAC-beta serine/threonine-protein kinase [Source:RefSeq peptide;Acc:NP_937789]
- Human Orthologue:
- AKT2
- Human Description:
- v-akt murine thymoma viral oncogene homolog 2 [Source:HGNC Symbol;Acc:392]
- Mouse Orthologue:
- Akt2
- Mouse Description:
- thymoma viral proto-oncogene 2 Gene [Source:MGI Symbol;Acc:MGI:104874]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7448 | Missense | Mutation detected in F1 DNA | During 2018 |
sa23364 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa7448
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026767 | Missense | 37 | 479 | 3 | 14 |
ENSDART00000130397 | Missense | 37 | 479 | 2 | 14 |
- Genomic Location (Zv9):
- Chromosome 18 (position 39034589)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 40747306 GRCz11 18 40737498 - KASP Assay ID:
- 554-4039.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACTTGGAGGCCTCGATATTTCATCCTAAAGAGTGATGGCTCTTTTATCG[G/A]CTACAAGGAGAAGCCGGAGACGTCAGAYGCCAATCAGCCACCTCTCAATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23364
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026767 | Nonsense | 440 | 479 | 13 | 14 |
ENSDART00000130397 | Nonsense | 440 | 479 | 12 | 14 |
- Genomic Location (Zv9):
- Chromosome 18 (position 39014360)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 40727077 GRCz11 18 40717269 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTTCAAGCCGCAAGTGACCTCAGAGACAGACACACGCTACTTTGATGAT[G/T]AGTTCACTGCACAGACCATTACTGTCACTCCACCTGACCAATGTGAGTAC
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: