acvr2a

Ensembl ID:
ENSDARG00000011188
ZFIN ID:
ZDB-GENE-980526-227
Description:
activin receptor type-2A [Source:RefSeq peptide;Acc:NP_001103748]
Human Orthologue:
ACVR2A
Human Description:
activin A receptor, type IIA [Source:HGNC Symbol;Acc:173]
Mouse Orthologue:
Acvr2a
Mouse Description:
activin receptor IIA Gene [Source:MGI Symbol;Acc:MGI:102806]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34654 Essential Splice Site Available for shipment Available now
sa34653 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002428 Essential Splice Site 89 514 2 11
ENSDART00000105492 Essential Splice Site 87 512 4 13
ENSDART00000129522 Essential Splice Site 70 495 1 10

The following transcripts of ENSDARG00000011188 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 26458517)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25614303
GRCz11 9 25425172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATAGTAAAGCAAGGCTGCTGGCTTGATGATGTCAACTGCTATGACAG[G/A]TATTCCCTACTGCTTTTATGGCATTTGACATTAATAAGGAGTCAGGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002428 Essential Splice Site 126 514 None 11
ENSDART00000105492 Essential Splice Site 124 512 None 13
ENSDART00000129522 Essential Splice Site 107 495 None 10

The following transcripts of ENSDARG00000011188 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 26452542)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25608328
GRCz11 9 25419197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGCAACGAGAAGTTCTTCTACAATCCCAACACGGCGCCAGTTCAGAG[T/A]AAGGCTCCATTCAGCGACACAAAAAGCGACACAAAAGTCTTTAAGGGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link