zfpl1

Ensembl ID:
ENSDARG00000011186
ZFIN ID:
ZDB-GENE-040426-1255
Description:
Zinc finger protein-like 1 [Source:UniProtKB/Swiss-Prot;Acc:P62447]
Human Orthologue:
ZFPL1
Human Description:
zinc finger protein-like 1 [Source:HGNC Symbol;Acc:12868]
Mouse Orthologue:
Zfpl1
Mouse Description:
zinc finger like protein 1 Gene [Source:MGI Symbol;Acc:MGI:1891017]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40582 Essential Splice Site Mutation detected in F1 DNA During 2018
sa309 Nonsense Confirmed mutation in F2 line During 2018
sa20560 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028945 Essential Splice Site 72 317 3 9
Genomic Location (Zv9):
Chromosome 5 (position 63843436)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 52317013
GRCz11 5 52963606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATCCAACCATTAGATTCCCAGGATACTGTTCGACTAGTTTGTTATGG[T/G]GAGAAAATAAATGCACTTGGTTTCATTCATTAAACATGCTTACAATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa309
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028945 Nonsense 76 317 4 9
Genomic Location (Zv9):
Chromosome 5 (position 63842545)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 52316122
GRCz11 5 52962715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTAATAAATGTCTGTACATTTATTCTTTTGTAAGATTTGTTCCACTG[G/A]TCGTGTCTGAATGAGTTGGCCTCTCATCAACCTCTCAACACGGCACCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028945 Nonsense 121 317 4 9
Genomic Location (Zv9):
Chromosome 5 (position 63842412)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 52315989
GRCz11 5 52962582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTCCACCCCGAAACCTGGCTAGTCCTGTTGCTGACATGCTCAGAGAA[C/T]AACTGTCCTCTGTGAACTGGGCTAGAGCAGGATTAGGTCTTCCACTGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link