atp6v1d

Ensembl ID:
ENSDARG00000011175
ZFIN ID:
ZDB-GENE-040426-727
Description:
V-type proton ATPase subunit D [Source:RefSeq peptide;Acc:NP_001161426]
Human Orthologue:
ATP6V1D
Human Description:
ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D [Source:HGNC Symbol;Acc:13527]
Mouse Orthologue:
Atp6v1d
Mouse Description:
ATPase, H+ transporting, lysosomal V1 subunit D Gene [Source:MGI Symbol;Acc:MGI:1921084]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37172 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023488 Essential Splice Site 175 248 8 9
Genomic Location (Zv9):
Chromosome 20 (position 51428432)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51280501
GRCz11 20 51093721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGCTTTAAGAACAGGTACTAATGTGACTCTTGTGTTTTGTCCTCGC[A/T]GTGATTATTCCCAGAATTGAGCGCACTCTCACCTACATCATTACTGAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link