si:ch211-12m10.1
- Ensembl ID:
- ENSDARG00000011171
- ZFIN ID:
- ZDB-GENE-060503-100
- Description:
- Novel protein similar to vertebrate odz, odd Oz/ten-m homolog 2 (Drosophila) (ODZ2) [Source:UniProtK
- Human Orthologue:
- ODZ2
- Human Description:
- odz, odd Oz/ten-m homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29943]
- Mouse Orthologue:
- Odz2
- Mouse Description:
- odd Oz/ten-m homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1345184]
Alleles
There are 11 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa45742 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa12677 |
Nonsense |
Available for shipment |
Available now |
sa14272 |
Nonsense |
Available for shipment |
Available now |
sa15048 |
Nonsense |
Available for shipment |
Available now |
sa13815 |
Nonsense |
Available for shipment |
Available now |
sa37350 |
Nonsense |
Available for shipment |
Available now |
sa9107 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa10500 |
Nonsense |
Available for shipment |
Available now |
sa23981 |
Nonsense |
Available for shipment |
Available now |
sa23982 |
Nonsense |
Available for shipment |
Available now |
sa43678 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa45742
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000040740 |
Essential Splice Site |
65 |
1473 |
2 |
9 |
ENSDART00000135591 |
Essential Splice Site |
1107 |
2515 |
18 |
25 |
- Genomic Location (Zv9):
- Chromosome 21 (position 30753098)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
21 |
31953022 |
GRCz11 |
21 |
31986280 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGTCATGCATGAGTATTGAGTTTTTATTCACTGTCGGCTCTTTCTTGC[A/G]GGAGTCGCACTGGATAAGAACGGCCTGATGTACTTTGTGGATGCTACAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12677
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 21 (position 30757398)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
21 |
31957322 |
GRCz11 |
21 |
31990580 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GGTYCCTGGCATTGATTACTCRCTCAGCAAACTTGCAATCCATTCTGCGT[T/A]GGAGAGCGCCACAGCTATCGCCATCTCCCACACAGGTGTGCTMTACATTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14272
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 21 (position 30768490)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
21 |
31968414 |
GRCz11 |
21 |
32001672 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GTACTYGTTTTGTTTACGTNNNNNNTTTCTCTTNNNNNNNNNNTCTCYCTCTGCAGTCCATGGTGT[T/A]GCTGCTYCAGCAAAGTCAAAAGCARTACGTCTTTGATTTTGATACAGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15048
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 21 (position 30769215)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
21 |
31969139 |
GRCz11 |
21 |
32002397 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCTTTCGCTCATTGATGTATTGGAKGACAGTGCAGTATGACAGCATGGGA[A/T]GAGTTATCAAAYGTGAGTTAAAGATTGGTCCCTATGCCAATACYACACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13815
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 21 (position 30769409)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
21 |
31969333 |
GRCz11 |
21 |
32002591 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTYCATTTGCTCAACCCGGGTAACAGTGCCCGTTTGCTGCCACTACGATA[T/A]GATCTTCGAGACCGAATTACGAGGTTGGGTGACATGCAGTAWCAACTCGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37350
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 21 (position 30769416)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
21 |
31969340 |
GRCz11 |
21 |
32002598 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCTCAACCCGGGTAACAGTGCCCGTTTGCTGCCACTACGATATGATCTT[C/T]GAGACCGAATTACGAGGTTGGGTGACATGCAGTATCAACTCGATGAGGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9107
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 21 (position 30769451)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
21 |
31969375 |
GRCz11 |
21 |
32002633 |
- KASP Assay ID:
- 2261-5824.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTACGATATGATCTTCGAGACCGAATTACGAGGTTGGGTGACATGCAGTA[T/A]CAACTCGATGARGACGGTGTGCTCATGCAGAGGGGCTCGGATGTATTTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10500
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 21 (position 30769451)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
21 |
31969375 |
GRCz11 |
21 |
32002633 |
- KASP Assay ID:
- 2261-5824.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTACGATATGATCTTCGAGACCGAATTACGAGGTTGGGTGACATGCAGTA[T/A]CAACTCGATGARGACGGTGTGCTCATGCAGAGGGGCTCGGATGTATTTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23981
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 21 (position 30769574)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
21 |
31969498 |
GRCz11 |
21 |
32002756 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGCGAGCCTACAGCCGCACAGCAGGAGGTTGGAGTGTCCGTTACCGTTA[C/A]GATGGCCTTGGTCGCAGAGTCTCCCGCAGAACAAGTGAAGGCGAGCATCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23982
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 21 (position 30769637)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
21 |
31969561 |
GRCz11 |
21 |
32002819 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCAGAGTCTCCCGCAGAACAAGTGAAGGCGAGCATCAGCAGTACTTCTA[T/A]GCAGACTTGAACTATCCCACTCGGGTCACCCATGTGTACAACCACACGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43678
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 21 (position 30769947)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
21 |
31969871 |
GRCz11 |
21 |
32003129 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTTCCATGGAGGGCTTTATGATTCTCTCACAAAGCTGGTGCATTTTGCC[C/T]AGAGAGACTATGATGTCCTGGCAGGAAGATGGATTGCACCTGACCATACG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: