ENSDARG00000011171 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

si:ch211-12m10.1

Ensembl ID:: ENSDARG00000011171
ZFIN ID:: ZDB-GENE-060503-100
Description:: Novel protein similar to vertebrate odz, odd Oz/ten-m homolog 2 (Drosophila) (ODZ2) [Source:UniProtK
Human Orthologue:: ODZ2
Human Description:: odz, odd Oz/ten-m homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29943]
Mouse Orthologue:: Odz2
Mouse Description:: odd Oz/ten-m homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1345184]

Alleles

There are 11 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa45742	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa12677	Nonsense	Available for shipment	Available now
sa14272	Nonsense	Available for shipment	Available now
sa15048	Nonsense	Available for shipment	Available now
sa13815	Nonsense	Available for shipment	Available now
sa37350	Nonsense	Available for shipment	Available now
sa9107	Nonsense	Mutation detected in F1 DNA	During 2018
sa10500	Nonsense	Available for shipment	Available now
sa23981	Nonsense	Available for shipment	Available now
sa23982	Nonsense	Available for shipment	Available now
sa43678	Nonsense	Mutation detected in F1 DNA	During 2018

Mutation Details

Allele Name:: sa45742
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > G
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040740	Essential Splice Site	65	1473	2	9
ENSDART00000135591	Essential Splice Site	1107	2515	18	25

Genomic Location (Zv9):

Chromosome 21 (position 30753098)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	21	31953022
GRCz11	21	31986280

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TCTGTCATGCATGAGTATTGAGTTTTTATTCACTGTCGGCTCTTTCTTGC[A/G]GGAGTCGCACTGGATAAGAACGGCCTGATGTACTTTGTGGATGCTACAAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa12677
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040740	Nonsense	179	1473	3	9
ENSDART00000135591	Nonsense	1221	2515	19	25

Genomic Location (Zv9):

Chromosome 21 (position 30757398)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	21	31957322
GRCz11	21	31990580

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GGTYCCTGGCATTGATTACTCRCTCAGCAAACTTGCAATCCATTCTGCGT[T/A]GGAGAGCGCCACAGCTATCGCCATCTCCCACACAGGTGTGCTMTACATTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa14272
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040740	Nonsense	648	1473	7	9
ENSDART00000135591	Nonsense	1690	2515	23	25

Genomic Location (Zv9):

Chromosome 21 (position 30768490)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	21	31968414
GRCz11	21	32001672

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GTACTYGTTTTGTTTACGTNNNNNNTTTCTCTTNNNNNNNNNNTCTCYCTCTGCAGTCCATGGTGT[T/A]GCTGCTYCAGCAAAGTCAAAAGCARTACGTCTTTGATTTTGATACAGCAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa15048
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040740	Nonsense	890	1473	7	9
ENSDART00000135591	Nonsense	1932	2515	23	25

Genomic Location (Zv9):

Chromosome 21 (position 30769215)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	21	31969139
GRCz11	21	32002397

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TCTTTCGCTCATTGATGTATTGGAKGACAGTGCAGTATGACAGCATGGGA[A/T]GAGTTATCAAAYGTGAGTTAAAGATTGGTCCCTATGCCAATACYACACAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa13815
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040740	Nonsense	954	1473	7	9
ENSDART00000135591	Nonsense	1996	2515	23	25

Genomic Location (Zv9):

Chromosome 21 (position 30769409)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	21	31969333
GRCz11	21	32002591

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CTYCATTTGCTCAACCCGGGTAACAGTGCCCGTTTGCTGCCACTACGATA[T/A]GATCTTCGAGACCGAATTACGAGGTTGGGTGACATGCAGTAWCAACTCGA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa37350
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040740	Nonsense	957	1473	7	9
ENSDART00000135591	Nonsense	1999	2515	23	25

Genomic Location (Zv9):

Chromosome 21 (position 30769416)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	21	31969340
GRCz11	21	32002598

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TGCTCAACCCGGGTAACAGTGCCCGTTTGCTGCCACTACGATATGATCTT[C/T]GAGACCGAATTACGAGGTTGGGTGACATGCAGTATCAACTCGATGAGGAC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa9107
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040740	Nonsense	968	1473	7	9
ENSDART00000135591	Nonsense	2010	2515	23	25
ENSDART00000040740	Nonsense	968	1473	7	9
ENSDART00000135591	Nonsense	2010	2515	23	25

Genomic Location (Zv9):

Chromosome 21 (position 30769451)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	21	31969375
GRCz11	21	32002633

KASP Assay ID:

2261-5824.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CTACGATATGATCTTCGAGACCGAATTACGAGGTTGGGTGACATGCAGTA[T/A]CAACTCGATGARGACGGTGTGCTCATGCAGAGGGGCTCGGATGTATTTGA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa10500
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040740	Nonsense	968	1473	7	9
ENSDART00000135591	Nonsense	2010	2515	23	25
ENSDART00000040740	Nonsense	968	1473	7	9
ENSDART00000135591	Nonsense	2010	2515	23	25

Genomic Location (Zv9):

Chromosome 21 (position 30769451)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	21	31969375
GRCz11	21	32002633

KASP Assay ID:

2261-5824.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CTACGATATGATCTTCGAGACCGAATTACGAGGTTGGGTGACATGCAGTA[T/A]CAACTCGATGARGACGGTGTGCTCATGCAGAGGGGCTCGGATGTATTTGA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa23981
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040740	Nonsense	1009	1473	7	9
ENSDART00000135591	Nonsense	2051	2515	23	25

Genomic Location (Zv9):

Chromosome 21 (position 30769574)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	21	31969498
GRCz11	21	32002756

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GAGCGAGCCTACAGCCGCACAGCAGGAGGTTGGAGTGTCCGTTACCGTTA[C/A]GATGGCCTTGGTCGCAGAGTCTCCCGCAGAACAAGTGAAGGCGAGCATCA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa23982
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040740	Nonsense	1030	1473	7	9
ENSDART00000135591	Nonsense	2072	2515	23	25

Genomic Location (Zv9):

Chromosome 21 (position 30769637)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	21	31969561
GRCz11	21	32002819

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CGCAGAGTCTCCCGCAGAACAAGTGAAGGCGAGCATCAGCAGTACTTCTA[T/A]GCAGACTTGAACTATCCCACTCGGGTCACCCATGTGTACAACCACACGAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa43678
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040740	Nonsense	1134	1473	7	9
ENSDART00000135591	Nonsense	2176	2515	23	25

Genomic Location (Zv9):

Chromosome 21 (position 30769947)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	21	31969871
GRCz11	21	32003129

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GCTTCCATGGAGGGCTTTATGATTCTCTCACAAAGCTGGTGCATTTTGCC[C/T]AGAGAGACTATGATGTCCTGGCAGGAAGATGGATTGCACCTGACCATACG

Associated Phenotype:

Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Diabetic retinopathy : Genome-wide meta-analysis for severe diabetic retinopathy. (View Study)
Immune response to smallpox vaccine (IL-6): Genome-wide analysis of polymorphisms associated with cytokine responses in smallpox vaccine recipients. (View Study)
Periodontal microbiota: Genome-wide association study of periodontal pathogen colonization. (View Study)
Uric acid levels: Genome-wide association of serum uric acid concentration: replication of sequence variants in an island population of the Adriatic coast of Croatia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: