arhgef18
- Ensembl ID:
- ENSDARG00000011157
- ZFIN ID:
- ZDB-GENE-040516-14
- Description:
- rho/rac guanine nucleotide exchange factor (GEF) 18 [Source:RefSeq peptide;Acc:NP_999983]
- Human Orthologue:
- ARHGEF18
- Human Description:
- Rho/Rac guanine nucleotide exchange factor (GEF) 18 [Source:HGNC Symbol;Acc:17090]
- Mouse Orthologue:
- Arhgef18
- Mouse Description:
- rho/rac guanine nucleotide exchange factor (GEF) 18 Gene [Source:MGI Symbol;Acc:MGI:2142567]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa1637 |
Nonsense |
F2 line generated |
During 2018 |
sa25861 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa16319 |
Essential Splice Site |
Available for shipment |
Available now |
sa19819 |
Nonsense |
Available for shipment |
Available now |
sa38343 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa39886 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa1637
- Current Status:
-
F2 line generated
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 37247605)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
37544315 |
GRCz11 |
2 |
37526772 |
- KASP Assay ID:
- 554-1577.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ATCTCGTCATCTACACAGAATGCCATTATAATGTGCTGCGTGACGATCTG[G/T]AGTCCGATGCTCGGGACTTTGAGGCTCCSACCWGGAGTTTAGCTGTTGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25861
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 2 (position 37247495)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
37544205 |
GRCz11 |
2 |
37526662 |
- KASP Assay ID:
- 554-6245.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGAAAAACTTTTCCAAAGATGCCGTCAAAAGACAGGATGTAATACACGG[T/A]AAGGGACTGTGGTCTATTTTTGTTGTTTATTTGTTTATTTGTTTTTCATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16319
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 2 (position 37247495)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
37544205 |
GRCz11 |
2 |
37526662 |
- KASP Assay ID:
- 554-6245.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTGAAAAACTTTTCCAAAGATGCCGWCAAAAGACAGGATGTAATACACGG[T/G]AAGGGACTGTGGTCTWTTTTTKTTNGTTTATTTGTTTATTTGTTTTWCATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19819
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 37247294)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
37544004 |
GRCz11 |
2 |
37526461 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAATGTGTACATTCGGGAGTTGCGTAACACCCTACAAATGGATGAGACA[C/T]GACTGGAAAGGCTGTTTCCACAGGTGGAAAACCTGCTGGAGGTGCACCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38343
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 2 (position 37242456)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
37539166 |
GRCz11 |
2 |
37521623 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTCAACTGGAGGGTCACGAACAACAAAGGCAAAGGTGATAAGCATACAG[G/A]TGAGATAAAAATTACAGCTGGATTATCTAGTAGTTGTTTACCAATCTTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39886
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 37235649)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
37532359 |
GRCz11 |
2 |
37514816 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGAGCGCCATCCGCTACGTGGGAATGCAGCAGAGCCCCTGCAGGGAGAA[C/T]GACTACTCACCGGAGCCCTGAAAGATGGTGAGATTTACACTGCACAGTAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: