uqcrb

Ensembl ID:
ENSDARG00000011146
ZFIN ID:
ZDB-GENE-050522-542
Description:
cytochrome b-c1 complex subunit 7 [Source:RefSeq peptide;Acc:NP_001019613]
Human Orthologue:
UQCRB
Human Description:
ubiquinol-cytochrome c reductase binding protein [Source:HGNC Symbol;Acc:12582]
Mouse Orthologue:
Uqcrb
Mouse Description:
ubiquinol-cytochrome c reductase binding protein Gene [Source:MGI Symbol;Acc:MGI:1914780]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23598 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005191 Essential Splice Site 7 111 None 4
ENSDART00000125168 Essential Splice Site 7 111 None 5
Genomic Location (Zv9):
Chromosome 19 (position 45561138)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44459360
GRCz11 19 44054933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCTGTGCGTTTCTCTCAGAGAACAAAAATGGCGGCGAGGGCACCAGG[T/A]AAAAATGTTGTTCGATTTGTATTAGCGTTATGTGAAACTGTGATTTAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link