snrpb

Ensembl ID:
ENSDARG00000011125
ZFIN ID:
ZDB-GENE-040426-1819
Description:
small nuclear ribonucleoprotein polypeptides B and B1 [Source:RefSeq peptide;Acc:NP_991230]
Human Orthologue:
SNRPN
Human Description:
small nuclear ribonucleoprotein polypeptide N [Source:HGNC Symbol;Acc:11164]
Mouse Orthologue:
Snrpn
Mouse Description:
small nuclear ribonucleoprotein N Gene [Source:MGI Symbol;Acc:MGI:98347]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31546 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011663 Nonsense 67 239 3 7
Genomic Location (Zv9):
Chromosome 6 (position 57433072)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 57486134
GRCz11 6 57482998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGACCCAAGAACTCTAAGCAGCCGGAGCGTGAGGAGAAGAGGGTTT[T/A]AGGTCTGGTTCTGCTCAGAGGAGAGAATCTGGTGTCCATGACTGTAGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link