
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ccna2
- Ensembl ID:
- ENSDARG00000011094
- ZFIN ID:
- ZDB-GENE-020418-1
- Description:
- cyclin-A2 [Source:RefSeq peptide;Acc:NP_694481]
- Human Orthologue:
- CCNA2
- Human Description:
- cyclin A2 [Source:HGNC Symbol;Acc:1578]
- Mouse Orthologue:
- Ccna2
- Mouse Description:
- cyclin A2 Gene [Source:MGI Symbol;Acc:MGI:108069]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14296 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14296
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031498 | Nonsense | 213 | 261 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 14 (position 49305531)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 47383090 GRCz11 14 46370171 - KASP Assay ID:
- 2260-7918.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAAAACAGCCAGAYATCACAAACAGCATGCGTGCTATTCTAGTRGACTG[G/A]TTGGTGGAAGTGGGAGAAGAATACAAGCTACAGAACGAGACTCTTTACCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: