wdr3

Ensembl ID:
ENSDARG00000011079
ZFIN ID:
ZDB-GENE-030131-9830
Description:
WD repeat-containing protein 3 [Source:RefSeq peptide;Acc:NP_942574]
Human Orthologue:
WDR3
Human Description:
WD repeat domain 3 [Source:HGNC Symbol;Acc:12755]
Mouse Orthologue:
Wdr3
Mouse Description:
WD repeat domain 3 Gene [Source:MGI Symbol;Acc:MGI:2443143]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41397 Nonsense Mutation detected in F1 DNA During 2018
sa30916 Nonsense Mutation detected in F1 DNA During 2018
sa34610 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003648 Nonsense 316 938 9 27
ENSDART00000147892   None 61 None 4
ENSDART00000003648 Nonsense 316 938 9 27
ENSDART00000147892   None 61 None 4

The following transcripts of ENSDARG00000011079 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 21893057)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21048843
GRCz11 9 20859712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTTTTACTGTACTATCAGAGGAGGAAATCCAAAGAAAAATGGACAGA[A/T]AACTGAAGAAAGCCAAGAAAAAAGCCAAGTATGTTAGACCCTTGTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003648 Nonsense 316 938 9 27
ENSDART00000147892   None 61 None 4
ENSDART00000003648 Nonsense 316 938 9 27
ENSDART00000147892   None 61 None 4

The following transcripts of ENSDARG00000011079 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 21893057)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21048843
GRCz11 9 20859712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTTTTACTGTACTATCAGAGGAGGAAATCCAAAGAAAAATGGACAGA[A/T]AACTGAAGAAAGCCAAGAAAAAAGCCAAGTATGTTAGACCCTTGTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003648 Essential Splice Site 888 938 27 27
ENSDART00000147892 Splice Site None 61 None 4

The following transcripts of ENSDARG00000011079 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 21905624)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21061410
GRCz11 9 20872279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATAGGAGCAGATTGGGTAAGGCTCTGTTTTCTCATTTTCCTGTTTTC[A/G]GGATGTCCTGGGTTTCAACAGCGCTGGTCTTCAGTTCCTGCAGCGGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link