
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
GLRA3
- Ensembl ID:
- ENSDARG00000011066
- Description:
- glycine receptor, alpha 3 [Source:HGNC Symbol;Acc:4328]
- Human Orthologue:
- GLRA3
- Human Description:
- glycine receptor, alpha 3 [Source:HGNC Symbol;Acc:4328]
- Mouse Orthologue:
- Glra3
- Mouse Description:
- glycine receptor, alpha 3 subunit Gene [Source:MGI Symbol;Acc:MGI:95749]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18125 | Essential Splice Site | Available for shipment | Available now |
sa32718 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa18125
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009777 | Essential Splice Site | 173 | 431 | 14 | 17 |
- Genomic Location (Zv9):
- Chromosome 1 (position 38850945)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 37721498 GRCz11 1 38440676 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATTACTACCAATACTGAAAAATCTAAATGTTTMTCTTGCTCTTTCATCTA[G/A]TTGGTTACACAATGAATGACCTGATCTTTGAGTGGCAAGAAAAGGGACCY
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32718
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009777 | Nonsense | 293 | 431 | 16 | 17 |
- Genomic Location (Zv9):
- Chromosome 1 (position 38836319)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 37707244 GRCz11 1 38426422 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAATTAAAGGTTTCTGAGAAGGCATGTGTTTGTGTCCTGCAGGTGTCCTA[T/A]GTGAAGGCTATCGACATCTGGATGGCTGTGTGTTTGCTGTTTGTGTTTTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: