si:ch211-8a9.3
- Ensembl ID:
- ENSDARG00000011042
- ZFIN ID:
- ZDB-GENE-040724-229
- Description:
- piggyBac transposable element-derived protein 5 [Source:RefSeq peptide;Acc:NP_001139077]
- Human Orthologue:
- PGBD5
- Human Description:
- piggyBac transposable element derived 5 [Source:HGNC Symbol;Acc:19405]
- Mouse Orthologue:
- Pgbd5
- Mouse Description:
- piggyBac transposable element derived 5 Gene [Source:MGI Symbol;Acc:MGI:2429955]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa42197 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa35479 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa9658 |
Nonsense |
Available for shipment |
Available now |
sa14201 |
Essential Splice Site |
Available for shipment |
Available now |
sa6298 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa42198 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa42197
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000028285 |
Essential Splice Site |
103 |
518 |
1 |
7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24247277)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
23892937 |
GRCz11 |
13 |
24023387 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGCGATACGCTGCGGGACCTCAGCCTGCCTCACTACCAGGACACGCACG[G/A]TAAGTTGGTGTAACGGTGATGAACGCTGATTAGTGTAAATGCAATGCAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35479
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000028285 |
Nonsense |
175 |
518 |
2 |
7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24258036)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
23903696 |
GRCz11 |
13 |
24034146 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAATGAAAGCATTTCTAGGCTACGTTACATCTACTAGCGTGAACCGCTG[T/A]GAGTCGGTGTTAAGCATCTGGAGCAGTGGTTTCTTCAGTAACCGCAGCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9658
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000028285 |
Nonsense |
401 |
518 |
5 |
7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24273900)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
23919560 |
GRCz11 |
13 |
24050010 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GGCCAGTCTCATGTTAAGATGAGAGGAAATATGTCCATAATCAACTGGTA[C/A]AACAAAGGCAACTTCAGGTTTCTCACTAATGCCTACTCTCCTACTAAAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14201
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000028285 |
Essential Splice Site |
419 |
518 |
5 |
7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24273954)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
23919614 |
GRCz11 |
13 |
24050064 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAAGGCAACTTCAGGTTTCTCACTAATGCCTACTCTCCTACTAAAGAAGG[T/G]AAGAAAAACAYACAAAAGACWGGYTYTACATTTCCTYTAGCTTAAATGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6298
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000028285 |
Nonsense |
431 |
518 |
6 |
7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24277807)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
23923467 |
GRCz11 |
13 |
24053917 |
- KASP Assay ID:
- 554-4635.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCTCCTACTGTAGGTGTGATCATTAAGAGGAAGAGTGGAGAAATCCCATG[T/A]CCCCTTGCTGTGGAGGCCTTCGCTGCACACCTGAGTTACATCTGCAAATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42198
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000028285 |
Nonsense |
452 |
518 |
6 |
7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24277870)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
23923530 |
GRCz11 |
13 |
24053980 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGGCCTTCGCTGCACACCTGAGTTACATCTGCAAATATGATGACAAGTA[C/A]AGCAAGTGAGTTTGACCAGGAATCAAAGCAAGAGTTCAGTCCCCTAAAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: