zgc:92907

Ensembl ID:
ENSDARG00000011026
ZFIN ID:
ZDB-GENE-040718-161
Description:
Zgc:92907 [Source:UniProtKB/TrEMBL;Acc:Q6DGI5]
Mouse Orthologues:
Alg13, Glt28d2
Mouse Descriptions:
asparagine-linked glycosylation 13 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914824]
glycosyltransferase 28 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2443773]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42410 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010512 Nonsense 149 164 4 4
Genomic Location (Zv9):
Chromosome 14 (position 31837647)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30627454
GRCz11 14 30967768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGTTGAGGGAAATGGATCTGACAACTTTGAGACCTTTTGCGCCTGGT[G/T]AACCGCAGAACTTTGCCAAGTTTTTAGATAAAGCCGTCGGACTTGTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link