zgc:112079

Ensembl ID:
ENSDARG00000010941
ZFIN ID:
ZDB-GENE-050522-242
Description:
Uncharacterized glycosyltransferase AGO61 [Source:UniProtKB/Swiss-Prot;Acc:Q5NDE5]
Human Orthologue:
C3orf39
Human Description:
chromosome 3 open reading frame 39 [Source:HGNC Symbol;Acc:25902]
Mouse Orthologue:
C85492
Mouse Description:
expressed sequence C85492 Gene [Source:MGI Symbol;Acc:MGI:2143424]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36041 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25003 Nonsense Mutation detected in F1 DNA During 2018
sa11424 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010739 Essential Splice Site 47 578 2 3
ENSDART00000125642 Essential Splice Site 54 585 1 2
ENSDART00000139432 Essential Splice Site 54 585 2 3
Genomic Location (Zv9):
Chromosome 16 (position 9459226)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8245165
GRCz11 16 8158894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGAAGAGGAGCTACAGCTTACACGCCAGTCACAAGAATTTTCACAG[G/T]TGCACAGGGTTATGATAACTTTGCTTGTTGAGATTAATTGTGAAGGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010739 Nonsense 372 578 3 3
ENSDART00000125642 Nonsense 379 585 2 2
ENSDART00000139432 Nonsense 379 585 3 3
Genomic Location (Zv9):
Chromosome 16 (position 9461561)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8247500
GRCz11 16 8161229
KASP Assay ID:
554-7697.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGTGGTGCAGCTGTGGTCGAACTCTTCCCTTATGGTGTGAACCCGGAA[C/T]AGTACACTCCCTACAAAACCTTGGCCTCCTTACCTGGCATGGACTTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010739 Nonsense 532 578 3 3
ENSDART00000125642 Nonsense 539 585 2 2
ENSDART00000139432 Nonsense 539 585 3 3
Genomic Location (Zv9):
Chromosome 16 (position 9462043)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8247982
GRCz11 16 8161711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGAGGTGAAATATGAGGTGTGGATCCAGGAACAGGGAGAGAACACRTA[T/A]ATGCCTTACATTCTGCCCCACCARAACTACACCTTTTCAGAGAACATYAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link