
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:152769
- Ensembl ID:
- ENSDARG00000010905
- ZFIN ID:
- ZDB-GENE-060929-60
- Description:
- Methyltransferase-like protein 13 [Source:UniProtKB/Swiss-Prot;Acc:A5WVX1]
- Human Orthologue:
- METTL13
- Human Description:
- methyltransferase like 13 [Source:HGNC Symbol;Acc:24248]
- Mouse Orthologue:
- Mettl13
- Mouse Description:
- methyltransferase like 13 Gene [Source:MGI Symbol;Acc:MGI:1918699]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10291 | Nonsense | Available for shipment | Available now |
sa29323 | Missense | Mutation detected in F1 DNA | During 2018 |
sa15174 | Nonsense | Available for shipment | Available now |
sa9568 | Nonsense | Available for shipment | Available now |
sa43401 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa10291
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000021394 | Nonsense | 89 | 690 | 2 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 14853276)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 15042522 GRCz11 20 14938502 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTCAGCTGACCAACATTGACATCAGCGAGACGGTGGTCTCCCATATGAAC[C/T]AGAGGAATGCAGAGCGCCGTCCAGACCTCTCCTTCCAGCAGCTGGATGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29323
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000021394 | Missense | 153 | 690 | 2 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 14853084)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 15042330 GRCz11 20 14938310 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGGCCGGATGCTGGCAGAGGTTGGCAGAGTTTTGGCTGTGGGCGGGAGG[T/G]ATGTCTGCATAACGTTAGCCCAGGAGCATGTCATAAAGTTAGCAGTGGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15174
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000021394 | Nonsense | 336 | 690 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 14850380)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 15039626 GRCz11 20 14935606 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGTCCAGTGCAAAATTCAGACGTCTTGTCATTGTGGCAATGCATCGAGAC[C/T]AAGAATAWGAAGACATGCAGGCTGTCCAATCAGAGCTCTCGCCAGTGGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9568
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000021394 | Nonsense | 338 | 690 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 14850372)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 15039618 GRCz11 20 14935598 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAAAATTCAGACGTCTTGTCATTGTGGCAATGCATCGAGACCAAGAATA[T/A]GAAGACATGCAGGCTGTCCAATCAGAGCTCTCGCCAGTGGTCATGGAACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43401
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000021394 | Essential Splice Site | 554 | 690 | 6 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 14847634)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 15036880 GRCz11 20 14932860 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTACACTGGGAGACGGACTGGAGCACATCACAACCCTGGAGAGTGAAGG[T/A]GAGAAAGCATCTAGATCAGAGGCCGGCCGTACACTGTGCATCTTTGTTTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: