zgc:152769

Ensembl ID:
ENSDARG00000010905
ZFIN ID:
ZDB-GENE-060929-60
Description:
Methyltransferase-like protein 13 [Source:UniProtKB/Swiss-Prot;Acc:A5WVX1]
Human Orthologue:
METTL13
Human Description:
methyltransferase like 13 [Source:HGNC Symbol;Acc:24248]
Mouse Orthologue:
Mettl13
Mouse Description:
methyltransferase like 13 Gene [Source:MGI Symbol;Acc:MGI:1918699]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10291 Nonsense Available for shipment Available now
sa29323 Missense Mutation detected in F1 DNA During 2018
sa15174 Nonsense Available for shipment Available now
sa9568 Nonsense Available for shipment Available now
sa43401 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021394 Nonsense 89 690 2 8
Genomic Location (Zv9):
Chromosome 20 (position 14853276)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15042522
GRCz11 20 14938502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAGCTGACCAACATTGACATCAGCGAGACGGTGGTCTCCCATATGAAC[C/T]AGAGGAATGCAGAGCGCCGTCCAGACCTCTCCTTCCAGCAGCTGGATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021394 Missense 153 690 2 8
Genomic Location (Zv9):
Chromosome 20 (position 14853084)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15042330
GRCz11 20 14938310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCCGGATGCTGGCAGAGGTTGGCAGAGTTTTGGCTGTGGGCGGGAGG[T/G]ATGTCTGCATAACGTTAGCCCAGGAGCATGTCATAAAGTTAGCAGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021394 Nonsense 336 690 3 8
Genomic Location (Zv9):
Chromosome 20 (position 14850380)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15039626
GRCz11 20 14935606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCCAGTGCAAAATTCAGACGTCTTGTCATTGTGGCAATGCATCGAGAC[C/T]AAGAATAWGAAGACATGCAGGCTGTCCAATCAGAGCTCTCGCCAGTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021394 Nonsense 338 690 3 8
Genomic Location (Zv9):
Chromosome 20 (position 14850372)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15039618
GRCz11 20 14935598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAAATTCAGACGTCTTGTCATTGTGGCAATGCATCGAGACCAAGAATA[T/A]GAAGACATGCAGGCTGTCCAATCAGAGCTCTCGCCAGTGGTCATGGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021394 Essential Splice Site 554 690 6 8
Genomic Location (Zv9):
Chromosome 20 (position 14847634)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15036880
GRCz11 20 14932860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACACTGGGAGACGGACTGGAGCACATCACAACCCTGGAGAGTGAAGG[T/A]GAGAAAGCATCTAGATCAGAGGCCGGCCGTACACTGTGCATCTTTGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link