slc7a14a

Ensembl ID:
ENSDARG00000010816
ZFIN ID:
ZDB-GENE-070912-112
Description:
Novel protein similar to vertebrate solute carrier 2 (Facilitated glucose transporter) family member
Human Orthologue:
SLC7A14
Human Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 [Source:HGNC Symbol;
Mouse Orthologue:
Slc7a14
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 Gene [Source:MGI Sym

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39839 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44532 Nonsense Mutation detected in F1 DNA During 2018
sa14391 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032618 Essential Splice Site 181 785 3 7
ENSDART00000137746 Essential Splice Site 181 785 4 9
ENSDART00000143517   None 36 None 2
Genomic Location (Zv9):
Chromosome 2 (position 26106126)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26302322
GRCz11 2 25957956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAACATCTTCAGATCTTTCAAAAATATTCCTCCTTTATAACCTGTTA[G/T]GTAAAGGGGAGCAGTCATATCCGGACATCCTGGCGCTGGTCATAGGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032618 Nonsense 589 785 6 7
ENSDART00000137746 Nonsense 589 785 7 9
ENSDART00000143517   None 36 None 2
Genomic Location (Zv9):
Chromosome 2 (position 26133528)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26329724
GRCz11 2 25985358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCATCCTGATCTTCTGCTTCTGCTCCCTTATCATCTTCGGCTCGGGT[C/T]AGATCGCTGATGGTCAGTGGTGGGCCGTCCTGCTGCTGGTGGTGCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032618 Nonsense 730 785 7 7
ENSDART00000137746 Nonsense 730 785 8 9
ENSDART00000143517   None 36 None 2
Genomic Location (Zv9):
Chromosome 2 (position 26136465)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26332661
GRCz11 2 25988295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAGACCAAGGACCGTTCCAGARCTGGGGCAAAGGTGGCCAGCAGAAA[C/T]AGCCACARCAGGAGCAGAGCGAGCCTCAGTCTGATGGCCTGGACAGGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link