
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tfeb
- Ensembl ID:
- ENSDARG00000010794
- ZFIN ID:
- ZDB-GENE-090807-3
- Human Orthologue:
- TFEB
- Human Description:
- transcription factor EB [Source:HGNC Symbol;Acc:11753]
- Mouse Orthologue:
- Tcfeb
- Mouse Description:
- transcription factor EB Gene [Source:MGI Symbol;Acc:MGI:103270]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16652 | Essential Splice Site | Available for shipment | Available now |
sa38837 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa16652
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006580 | Essential Splice Site | 67 | 491 | 1 | 8 |
- Genomic Location (Zv9):
- Chromosome 11 (position 23145132)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 22151363 GRCz11 11 22311931 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCAACACACTTCCAGGGACCCATGCAGGTGCCTGTTGAAGTGCTAAAGG[T/C]AGGTGTATCCATCAGCCTGTGTATCTGGGTTTGACTTAAAGCATATTTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38837
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006580 | Nonsense | 350 | 491 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 11 (position 23125909)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 22132140 GRCz11 11 22292708 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCACGGCCTCCCCAGCAACTCCCCATCTGGCCTGACCAACACTGACCAC[C/T]AAAACCCCTTCATCAAGCAAGAAAGCAGCCCTGAGGAGAACCACCTCCAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Attention deficit hyperactivity disorder: Molecular genetics of adult ADHD: converging evidence from genome-wide association and extended pedigree linkage studies. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: