
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dla
- Ensembl ID:
- ENSDARG00000010791
- ZFIN ID:
- ZDB-GENE-980526-29
- Description:
- Delta-like protein A [Source:UniProtKB/Swiss-Prot;Acc:Q6DI48]
- Human Orthologue:
- DLL1
- Human Description:
- delta-like 1 (Drosophila) [Source:HGNC Symbol;Acc:2908]
- Mouse Orthologue:
- Dll1
- Mouse Description:
- delta-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104659]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19611 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19611
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006180 | Essential Splice Site | 262 | 800 | 5 | 13 |
ENSDART00000012104 | Essential Splice Site | 225 | 772 | 4 | 11 |
ENSDART00000126339 | Essential Splice Site | 225 | 763 | 4 | 12 |
- Genomic Location (Zv9):
- Chromosome 1 (position 54581544)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 53355047 GRCz11 1 54014790 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGAGAAATCATCTGCGATGCTGGGTGGAAAGGCCAATACTGCACAGAAC[G/A]TGAGTACTTATATTTAATATAACAATCATTGCATATTAAAGGGATAGTTC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: