zgc:55557

Ensembl ID:
ENSDARG00000010789
ZFIN IDs:
ZDB-GENE-040426-739, ZDB-GENE-040426-739
Description:
homer protein homolog 3 [Source:RefSeq peptide;Acc:NP_957407]
Human Orthologue:
HOMER3
Human Description:
homer homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:17514]
Mouse Orthologue:
Homer3
Mouse Description:
homer homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1347359]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4410 Essential Splice Site F2 line generated During 2018
sa5839 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa4410
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102553   223 360 7 10
ENSDART00000125563 Essential Splice Site 223 224 None 8
Genomic Location (Zv9):
Chromosome 11 (position 13670723)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13427546
GRCz11 11 13485205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTTCATGATGCTAACAGCAGCATTGAACAATGGAAAAAACAATTAGC[C/T]GAGTATCAAGAAGAAACAGAACGCCTCCGAGAGCAGGTAAGGAACAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102553 Nonsense 351 360 10 10
ENSDART00000125563   None 224 None 8
Genomic Location (Zv9):
Chromosome 11 (position 13688775)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13445598
GRCz11 11 13503257
KASP Assay ID:
554-3696.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGGCYATTGAAACACTAGATGTCAAAATCTATGACTTRAATGACCTT[C/T]GACAAAACCTGGCCAAGCTCCTGGACAAATGACCACTACATTTGGACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link