
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tlk2
- Ensembl ID:
- ENSDARG00000010779
- ZFIN ID:
- ZDB-GENE-060623-36
- Description:
- Serine/threonine-protein kinase tousled-like 2 [Source:UniProtKB/Swiss-Prot;Acc:Q1ECX4]
- Human Orthologue:
- TLK2
- Human Description:
- tousled-like kinase 2 [Source:HGNC Symbol;Acc:11842]
- Mouse Orthologue:
- Tlk2
- Mouse Description:
- tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI Symbol;Acc:MGI:1346023]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14440 | Nonsense | Available for shipment | Available now |
sa45138 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa26040 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa18506 | Nonsense | Available for shipment | Available now |
sa10364 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14440
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006490 | Nonsense | 124 | 697 | 7 | 21 |
ENSDART00000141937 | Nonsense | 124 | 697 | 6 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 19584931)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 19547966 GRCz11 3 19697706 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TRTTGATGGTAAATAGAAATGTTTGTTTTGGTTTTGATTGACAGGWGCAG[C/T]AAGGAAGCCCCTCCTCCATCAGTTCAGTAAACACAGAYCACTCCCACACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45138
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006490 | Essential Splice Site | 225 | 697 | 9 | 21 |
ENSDART00000141937 | Essential Splice Site | 225 | 697 | 8 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 19589510)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 19552545 GRCz11 3 19702285 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGCCTCAATAAATGTGTGACCATGAGTAAGAAACTGCTTATCGAAAAGG[T/C]AAACAGATTTTGCTTAGTATTGTTCTTTATGTATGCCGCATTCTTTAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26040
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006490 | Nonsense | 243 | 697 | 10 | 21 |
ENSDART00000141937 | Nonsense | 243 | 697 | 9 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 19589711)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 19552746 GRCz11 3 19702486 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAAACAGGAGAAAATTGCTTGCAGAGAAAAGAGCATGCAGGACCGACTA[C/T]GACTTGGTCATTTCACCACTGTACGACACGGAGCCTCATTTACAGAGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18506
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006490 | Nonsense | 441 | 697 | 16 | 21 |
ENSDART00000141937 | Nonsense | 441 | 697 | 15 | 20 |
ENSDART00000006490 | Nonsense | 441 | 697 | 16 | 21 |
ENSDART00000141937 | Nonsense | 441 | 697 | 15 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 19597290)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 19560325 GRCz11 3 19710065 - KASP Assay ID:
- 2259-3305.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTTACTAAAATGTTTCTTGACATGTTTTTAGGCATGCCTGTCGAGAATA[T/A]AGAATCCAKAAAGAGCTGGACCATCCCAGAATAGTCAAAYTGTATGACTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10364
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006490 | Nonsense | 441 | 697 | 16 | 21 |
ENSDART00000141937 | Nonsense | 441 | 697 | 15 | 20 |
ENSDART00000006490 | Nonsense | 441 | 697 | 16 | 21 |
ENSDART00000141937 | Nonsense | 441 | 697 | 15 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 19597290)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 19560325 GRCz11 3 19710065 - KASP Assay ID:
- 2259-3305.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTTACTAAAATGTTTCTTGACATGTTTTTAGGCATGCCTGTCGAGAATA[T/A]AGAATCCATAAAGAGCTGGACCATCCCAGAATAGTCAAAYTGTATGACTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: