Q1JQ25_DANRE

Ensembl ID:
ENSDARG00000010586
Description:
LOC553441 protein [Source:UniProtKB/TrEMBL;Acc:Q1JQ25]
Human Orthologue:
TEX9
Human Description:
testis expressed 9 [Source:HGNC Symbol;Acc:29585]
Mouse Orthologue:
AC111135.1
Mouse Description:
Testis-expressed sequence 9 protein [Source:UniProtKB/Swiss-Prot;Acc:Q9D845]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34116 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40946 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024869 Essential Splice Site 95 422 3 12
Genomic Location (Zv9):
Chromosome 7 (position 35957658)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34231501
GRCz11 7 34502978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAGAAGCAAAAACAGCAGAAATTGTTCGAGATGCAGAAAAAATCATGG[T/A]AAGTCTATTGAAAAGTATGTTAAAAACAGCAAAGCATGCTATTAAAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024869 Essential Splice Site 350 422 10 12
Genomic Location (Zv9):
Chromosome 7 (position 35951977)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34225820
GRCz11 7 34497297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTGAGAAGACTAAAACTCAACTCAACAAACTTAAACAGAGCACTAAG[G/A]TAACCAAGGAATGTGTATTATGATATTTATATGATATTACGATATGTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link