pard3

Ensembl ID:
ENSDARG00000010583
ZFIN ID:
ZDB-GENE-030925-47
Description:
partitioning defective 3 homolog [Source:RefSeq peptide;Acc:NP_991298]
Human Orthologue:
PARD3
Human Description:
par-3 partitioning defective 3 homolog (C. elegans) [Source:HGNC Symbol;Acc:16051]
Mouse Orthologue:
Pard3
Mouse Description:
par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39915 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14266 Nonsense Available for shipment Available now
sa25888 Nonsense Mutation detected in F1 DNA During 2018
sa45116 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45117 Nonsense Mutation detected in F1 DNA During 2018
sa25889 Nonsense Mutation detected in F1 DNA During 2018
sa17998 Nonsense Available for shipment Available now
sa39916 Nonsense Mutation detected in F1 DNA During 2018
sa10740 Nonsense Available for shipment Available now
sa33005 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018729 Essential Splice Site 74 1112 2 21
ENSDART00000056402 Essential Splice Site 74 1127 2 22
ENSDART00000129134 Essential Splice Site 74 1332 2 24

The following transcripts of ENSDARG00000010583 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 43336630)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43386094
GRCz11 2 43235512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTGGACCTGGATGATGTGCTGTGTGATGTGGCCGATGACAAAGACAGA[G/A]TGAGCCATGCATTCAGACACACACACATACCACACAGACAGACAGACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018729 Nonsense 270 1112 6 21
ENSDART00000056402 Nonsense 270 1127 6 22
ENSDART00000129134 Nonsense 270 1332 6 24

The following transcripts of ENSDARG00000010583 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 43371681)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43421145
GRCz11 2 43270563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCRGTGGGACGTGCGGACACATGCTTGGAGCAMATGGGAGTGAGATCAT[T/A]GGAGTAAGWAACACGAACACTGTAAAAAATGCCACACAATTCCTTCATGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018729 Nonsense 296 1112 7 21
ENSDART00000056402 Nonsense 296 1127 7 22
ENSDART00000129134 Nonsense 296 1332 7 24

The following transcripts of ENSDARG00000010583 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 43374355)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43423819
GRCz11 2 43273237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCAATGACGGGGGTCCACTCGGCATCCATGTTGTCCCCTTCAGTGGT[C/T]GAGACCGCAGGTACACTGAAAAAAAATGGTGTTGTAAATATAATATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018729 Essential Splice Site 341 1112 9 21
ENSDART00000056402 Essential Splice Site 341 1127 9 22
ENSDART00000129134 Essential Splice Site 341 1332 9 24

The following transcripts of ENSDARG00000010583 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 43380593)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43430057
GRCz11 2 43279475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGCATAAACCTCCATTTTGTGTTTTGTTTTCTTTTTTGGTATGTTTTC[A/T]GAGCTCAGAACATGTTTCGTCAAGCAATGCGTTCTCCCGTCATCCTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018729 Nonsense 410 1112 9 21
ENSDART00000056402 Nonsense 410 1127 9 22
ENSDART00000129134 Nonsense 410 1332 9 24

The following transcripts of ENSDARG00000010583 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 43380800)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43430264
GRCz11 2 43279682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCAATGATCTGGACAGCGCTGCTCACCGATTGGCTCAACACAGACCA[C/T]AGCAACCCAATAACCATCTGGATACTGGCTCTCCCGTCCATCATCTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018729 Nonsense 627 1112 13 21
ENSDART00000056402 Nonsense 627 1127 13 22
ENSDART00000129134 Nonsense 627 1332 13 24

The following transcripts of ENSDARG00000010583 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 43392012)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43441476
GRCz11 2 43290894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAAGCCACGCTGACCTGGGCATCTTCGTCAAGTCTATTATCAATGGA[G/T]GAGCAGCTTGCAAGGTAGAAAAAATGCATCAGTAATATATACTACCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018729 Nonsense 649 1112 14 21
ENSDART00000056402 Nonsense 649 1127 14 22
ENSDART00000129134 Nonsense 649 1332 14 24

The following transcripts of ENSDARG00000010583 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 43394274)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43443738
GRCz11 2 43293156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAAGGCTGCGGGTCAACGATCAGCTTATTGCAGTCAATGGGGAGTCGT[T/A]RTTAGGGAAGACAAACCAGGATGCCATGGAAACGCTGCGCAAGTCCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018729 Nonsense 712 1112 15 21
ENSDART00000056402 Nonsense 712 1127 15 22
ENSDART00000129134 Nonsense 712 1332 15 24

The following transcripts of ENSDARG00000010583 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 43404119)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43453583
GRCz11 2 43303001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGAGGGTTAGAGCGAACACTGAGCCCGTCTCCTGATGACCATGAGCGG[C/T]GAATTTCACACTCACTGTATGGGATCGAGGGCCTTGATGACAACCTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018729 Nonsense 895 1112 18 21
ENSDART00000056402 Nonsense 910 1127 19 22
ENSDART00000129134 Nonsense 895 1332 18 24

The following transcripts of ENSDARG00000010583 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 43417739)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43467203
GRCz11 2 43316621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAYGGTGACATGCCGTTTCACCGGCCGCGACCACGGATTATAAGAGGA[C/T]GAGGCTGCAATGAGAGTTTCAGAGCTGCCATTGACAAATCCTACGACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018729 Essential Splice Site 1034 1112 20 21
ENSDART00000056402 Essential Splice Site 1049 1127 21 22
ENSDART00000129134 Essential Splice Site 1034 1332 20 24

The following transcripts of ENSDARG00000010583 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 43427162)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43476626
GRCz11 2 43326044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCATGCATCTGAAGAGGAGACTCGCAGAATGAAGCAAGAGCAGGAGAG[G/A]TAAACACACACACACACACACACACACACTAACCTTCATCATCATTAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link