spopla

Ensembl ID:
ENSDARG00000010563
ZFIN ID:
ZDB-GENE-050320-3
Description:
Speckle-type POZ protein-like A [Source:UniProtKB/Swiss-Prot;Acc:Q5BL35]
Human Orthologue:
SPOPL
Human Description:
speckle-type POZ protein-like [Source:HGNC Symbol;Acc:27934]
Mouse Orthologue:
Spopl
Mouse Description:
speckle-type POZ protein-like Gene [Source:MGI Symbol;Acc:MGI:1924107]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44702 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011922 Essential Splice Site 345 392 11 12
ENSDART00000129143 Essential Splice Site 347 394 11 12
Genomic Location (Zv9):
Chromosome 9 (position 10278816)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10082663
GRCz11 9 10054036
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCCTCCGACAGCTGGGCTGTAAAGATGGGAAAAACTGGAATAGCAAG[T/G]ATGTAATTAGCTGATATGTGTGACACAAGATTAATACCGAGCTCTTATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link