zgc:56698

Ensembl ID:
ENSDARG00000010482
ZFIN ID:
ZDB-GENE-030131-8295
Description:
proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein) [Source:RefSe
Human Orthologue:
PRG4
Human Description:
proteoglycan 4 [Source:HGNC Symbol;Acc:9364]
Mouse Orthologue:
Prg4
Mouse Description:
proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein) Gene [Source:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32889 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014785 Essential Splice Site 142 486 6 14
ENSDART00000139346   None 129 None 5
ENSDART00000142321   None 298 None 7
Genomic Location (Zv9):
Chromosome 2 (position 20573858)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21143281
GRCz11 2 20801343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCAGCATGTCTTGCAGCTCAGCAAAACCCAGATGTGATGAGATATGG[T/C]GAGCTCACATCAAAATATATGTGTACTATGGTTATATAAAACCTTATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link